from The Science Teacher, April 1986

Background:
Mitochondrial DNA passes from mother to offspring with no hereditary input from the father. Only the female ovum contains mitochondria. The male sperm head contains no mitochondria. As a result, all individuals that can be traced back to a common female ancestor should have the same mitochondrial DNA (mtDNA). It has been demonstrated that mrDNA mutates at a rate about 10 times that of nuclear DNA. Such mutations result in differences between the mrDNA of individuals who share a common ancestral mother. By knowing the rate of mtDNA mutation and the actual number of differences between two related individuals, it is possible to calculate the approximate time since they shared a common female ancestor.

Species A

AATCGGTACGCCGGAATTATATCGCGCTCTCGCTATCGTTGCCATGCCTAGCT

AGCTTTTAAACGTGCTAGCTAGCTACCTAGCTAATATACGATCGATCGAGGC

ATCGATCGATCGAGAGGGATAATAATCCGATCGATCGATCGATCGATCGATC

GAGGATCTATAGCTATATTCTATCTAGGGGAATCGATCGATCG

Species B

AATCGGTAAGCCGGAATTATATCGCTCTCTAGCTATGGTTGCCACGCCTAGGT

AGCTTTTAGACGTGCTTGCTAGTCACCTAGCTAAAATACCATCGATCGATGCA

TCGATCGATCGAGAGAGATATTAATACGATCGCTCGATCAATCTATCGATCG

AGGATCCATAGCTGTATACTATCTAGCGGAATCGATCGATCA

It is known that the rate of mitochondrial DNA mutation is 2 percent to 4 percent per million years. For purposes of this exercise, assume a rate of 3 percent per million years.

Problem: When did species A and species B share a common female ancestor?

Solution: Step 1. Carefully count the number of letters in species B that are different from species A. Record here _______________

Step 2. Divide this number by the total number of letters (200).

_____________ ÷ _____________ = _______________

Step 3. Multiply your answer to Step 2 by 100 to show the percentage difference between the two species.

_____________ x 100 = _______________ percent

Step 4. Now divide the percentage difference between the two species calculated in Step 3 by the percentage rate of change per million years.

____________ ÷ ______________ = million years

(if this answer is not a whole number, go back to Step 1 and count again)

Conclusion: Species A and B shared a common female ancestor approximately __________________ million years ago.